837 a 74x163 used as an excess 3 decimal counter

The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning

The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning

Ngày tải lên : 05/09/2013, 16:10
... first rigorous analysis of the direct and indirect evaporative systems, considering both the advantages and disadvantages and indicating and establishing some basis about their design, was developed ... water is provided and evaporated at that temperature Isolation Non-saturated air Saturated state had sat = h1 Tad sat RH = 100 % T1 RH1/ h1 Isolation Water suppy at Tad sat Figure Adiabatic saturation ... such a way that it can behave either as a direct evaporative cooler If outside air is dry, taking advantage of its evaporative cooling capacity; or as an indirect system if outside air is humid and...
  • 28
  • 652
  • 0
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY

USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY

Ngày tải lên : 13/04/2013, 10:29
... task for any company in a highly competitive market Although a company gets many benefits from its brand name, it is not easy to manage a strong brand To understand more how a company builds and ... skilled and specialized discipline It concerns with managing and maintaining a mix of factors, both tangible and intangible to attract consumer loyalty (Stobart, 1994) BRAND BRAND Organizational Associations ... many people have got accustomed to the Company’s AVS product name, LiOA The Company has also spent a lot in advertising in the local TV, newspapers and magazines The Company has planned an annual...
  • 67
  • 974
  • 0
Tài liệu Báo cáo khoa học: "A Text Input Front-end Processor as an Information Access Platform" doc

Tài liệu Báo cáo khoa học: "A Text Input Front-end Processor as an Information Access Platform" doc

Ngày tải lên : 20/02/2014, 18:20
... displayed manually, and that of type 3) is retrieved automatically but displayed manually In the first case of translation equivalents and grammatical information retrieval, "Eisaku Pen" automatically ... to Kana-Kanji conversion FEPs, and initially replaces most of the Japanese vocabulary items with English equivalents but maintains Japanese grammatical constructions When a user inputs Japanese ... original Japanese word "arigato" is regarded as a key word for retrieving and the example sentences which are assigned a key word "arigato" beforehand or include strings of "arigato" in the Japanese...
  • 5
  • 385
  • 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

Ngày tải lên : 14/03/2014, 23:20
... CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT ... AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG PPP6C-siR-Bottom PPP6C-forward PPP6C-reverse 2052 FEBS Journal 278 (2011) ... gene (and the b-actin gene as an endogenous control) by PCR PCR primers were as follows: PPP6C sense and PPP6C antisense as above; b-actin sense, 5¢-CGTGACATTAAGGAGAAGCTG -3 ; and b-actin antisense,...
  • 11
  • 396
  • 0
A Strategic Planning Approach - Defining Alternative Counterterrorism Strategies as an Illustration pot

A Strategic Planning Approach - Defining Alternative Counterterrorism Strategies as an Illustration pot

Ngày tải lên : 15/03/2014, 15:20
... network of leaders and groups that are able to communicate, transfer materials, and operate globally, while others view a secure base at which al Qaeda can recruit and train members and plan and resource ... had cells located in Germany, Morocco, Malaysia, Afghanistan, and Saudi Arabia See Kim Cragin and Scott Gerwehr, Disuading Terror: Strategic Influence and the Struggle Against Terrorism, Santa ... of Advanced Conventional Weapons, Santa Monica, Calif.: RAND Corporation, MG-510-DHS, 2007 23 Means J 22 A Strategic Planning Approach: Defining Alternative Counterterrorism Strategies as an...
  • 51
  • 196
  • 0
Báo cáo khoa học: Coenzyme A affects firefly luciferase luminescence because it acts as a substrate and not as an allosteric effector pot

Báo cáo khoa học: Coenzyme A affects firefly luciferase luminescence because it acts as a substrate and not as an allosteric effector pot

Ngày tải lên : 16/03/2014, 23:20
... intensity was attained (12 s) the formation of the inhibitory product antagonized by CoA has only began and the effect of CoA at that assay time was nil or a discrete activation (always less than 20%) ... similarity between rey luciferase and acyl-CoA synthetases, our achievement is not as strange as it seems to be and supports the theory that nowadays rey luciferase evolved from an ancestral acyl-CoA ... preincubating it with ATP, acetate, MgCl2, acetyl-CoA synthetase and inorganic pyrophosphatase (PPase) Then, we conrmed that treated acetyl-CoA was no longer antagonist of L-AMP in bioluminescent reactions...
  • 11
  • 475
  • 0
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

Ngày tải lên : 17/03/2014, 10:20
... heat shock proteins such as Hsp10 5a and Hsp70 in various mammalian cells Enhancement of thermoresistance of cells by SA Upon exposure to a sublethal heat treatment, mammalian cells acquire transient ... neutral red, and fixed with 1% formaldehyde containing 1% CaCl2 for The dye incorporated into viable cells was extracted with 50% ethanol containing 1% acetic acid, and absorbance at 540 nm was measured ... containing 0.4 mgÆmL)1 G418 antibiotic reagent (Wako Pure Chemical, Osaka, Japan) for weeks, and C3H10T1/2 cell lines stably transfected with pGL105 or p173OR plasmid, designated as pGL105/ C3H and...
  • 8
  • 470
  • 0
Đề Thi Thử Đại Học Khối A, A1, B, D Toán 2013 - Phần 37 - Đề 2 (có đáp án) ppt

Đề Thi Thử Đại Học Khối A, A1, B, D Toán 2013 - Phần 37 - Đề 2 (có đáp án) ppt

Ngày tải lên : 19/03/2014, 20:20
... thang vuông BCNM Ta có : SBCNM = MN BC BM 4a Trong : BC = 2a , MM BM = AB2 AM = 2a 3 0,5 4a 2a 2a 1 0a2 Vậy SBCNM = Khi : VSBCNM = SH SBCNM Tính SH : Ta có MAB MHS , suy : 2a a ... -2 ; -3 ) Ta có ( SAB) ( BCNM) S SAB BCNM BM Từ S hạ SH vuông góc với đường thẳngH BM SH (BCNM) hay SH đường cao hình chóp SBCNM N M Mặt khác : SA = AB.tan600 = a A D Suy : MA = SA B Lại ... giao tuyến c a C mp(BCM) với mp(SAD), mà BC // (SAD) nên NM // AD MN // BC MN SM 4a Do : MN AD SA 3 Vì AD (SAB) nên MN (SAB) , suy MN BM BC BM Vậy thiết diện mp(BCM) với hình chóp SABCD...
  • 6
  • 309
  • 0
Đề Thi Thử Đại Học Khối A, A1, B, D Toán 2013 - Phần 37 - Đề 4 (có đáp án) docx

Đề Thi Thử Đại Học Khối A, A1, B, D Toán 2013 - Phần 37 - Đề 4 (có đáp án) docx

Ngày tải lên : 19/03/2014, 20:20
... (1; 4;1)  A '(0; 4;1)  z  3  t  Gọi M giao điểm A B d  M (1; Lấy điểm N C©u 7b : 13 ; ) 3 Ta có MA+MB=MB+MA’ =A B  NA+NBVậy M (1; 13 ; ) 3 Cho (1  x  x )12  a0  a1 x  a2 x  a2 4 x 24 ... CJ  Ta cú O trọng tõm tam giỏc BA’C J Gọi H hỡnh chiếu O lờn (ABC) O Do ABC hỡnh chiếu vuụng gúc BA’C trờn (ABC) nờn H trọng tõm ABC A OH HM   A ' B AM 1  VOABC  OH S ABC  A ' B.S ABC  ...     y   Hay A( 2;0), B(0;2) Hay (d) cắt (C ) hai điểm phân biệt A, B Ta cú S ABC  CH AB (H hỡnh chiếu C trờn AB) C  (C )  ( ) S ABC max  CH max Dễ dàng thấy CH max    xC   d...
  • 5
  • 319
  • 0
Đề Thi Thử Đại Học Khối A, A1, B, D Toán 2013 - Phần 37 - Đề 5 (có đáp án) pptx

Đề Thi Thử Đại Học Khối A, A1, B, D Toán 2013 - Phần 37 - Đề 5 (có đáp án) pptx

Ngày tải lên : 19/03/2014, 20:20
...  a  3b  2 3 b  3c   1  b  3c1.1    b  3c  2 3 c  3a  1 1  c  3a 1.1    c  3a  2 3a  3b1.1  1 a  3b  b  3c  c  3a    a  b  c  6    6    3 ...  33 xyz  9    (*)  x y z x y z xyz xyz   0,25 1 áp dụng (*) ta có P  3 3 3 a  3b b  3c c  3a a  3b  b  3c  c  3a áp dụng Bất đẳng thức Côsi cho ba số dương ta có a  3b ... a2 A Suy SB a Tương tự ta có SC = a Gọi M trung điểm SA , hai tam giác SAB SAC hai tam giác cân nên MB  SA, MC  SA Suy SA  (MBC) 1 Ta có VS.ABC  VS.MBC  VA MBC  MA SMBC  SA.SMBC  SA.SMBC...
  • 6
  • 265
  • 0
Đề Thi Thử Đại Học Khối A, A1, B, D Toán 2013 - Phần 37 - Đề 6 (có đáp án) ppt

Đề Thi Thử Đại Học Khối A, A1, B, D Toán 2013 - Phần 37 - Đề 6 (có đáp án) ppt

Ngày tải lên : 19/03/2014, 20:20
... đối xứng A qua d1 Ta có: IA + IB = IA1 + IB A1 B IA + IB đạt giá trị nhỏ A1 B Khi A1 , I, B thẳng hàng I giao điểm A1 B d Do AB // d1 nên I trung điểm A1 B 36 33 15 *) Gọi H hình chiếu A lên d1 ... Gi E l trung im ca CD, k BH AE Ta cú ACD cõn ti A nờn CD AE Tng t BCD cõn ti B nờn CD BE Suy CD (ABE) CD BH M BH AE suy BH (ACD) Do ú BH = v gúc gia hai mt phng I 0,5 A 0,5 H D (ACD) v (BCD) l ... I(1; -3) ; bỏn kớnh R=5 Gi H l trung im AB thỡ AH =3 v IH AB suy IH =4 Mt khỏc IH= d( I; ) Vỡ d: 4x-3y+2=0 nờn PT ca cú dng 3x+4y+c=0 d(I; )= VIa 0,5 I vy cú t tha bi toỏn: 3x+4y+29=0 v 3x+4y-11=0...
  • 5
  • 232
  • 0
Đề Thi Thử Đại Học Khối A, A1, B, D Toán 2013 - Phần 37 - Đề 9 (có đáp án) pptx

Đề Thi Thử Đại Học Khối A, A1, B, D Toán 2013 - Phần 37 - Đề 9 (có đáp án) pptx

Ngày tải lên : 19/03/2014, 20:20
... tích tam giác AMN S AMN  2 0.25 AM AN sin 600  xy Thể tích tứ diện D.AMN V  S AMN DH  xy 12 Ta có: S AMN  S AMH  S AMH  0.25 1 xy.sin 600  x AH sin 30 0  y AH sin 30 2  x  y  3xy V ... n AB (1; 2); nBD (1; 7); n AC (a; b) (với a2 + b2 > 0) VTPT        đường thẳng AB, BD, AC Khi ta có: cos n AB , nBD  cos nAC , n AB      a  b 2 2  a  2b  a  b  a ... 0.25  3  ln 0.25  IV 1.0 D Dựng DH  MN  H Do  DMN    ABC   DH   ABC  mà D ABC tứ diện nên H tâm tam giác ABC B C 0.25 N H M A3 Trong tam giác vuông DHA: DH  DA  AH   ...
  • 7
  • 267
  • 0
Đề Thi Thử Đại Học Khối A, A1, B, D Toán 2013 - Phần 37 - Đề 10 (có đáp án) docx

Đề Thi Thử Đại Học Khối A, A1, B, D Toán 2013 - Phần 37 - Đề 10 (có đáp án) docx

Ngày tải lên : 19/03/2014, 20:20
... O H a K IV(1 điểm) C B Từ giả thiết AC = 2a ; BD = 2a AC ,BD vuông góc với trung điểm O đường chéo.Ta có tam giác ABO vuông O AO = a ; BO = a , A BD  600 Hay tam giác ABD Từ giả thiết hai mặt ... ta có OI  SK; AB  OI  OI  (SAB) , hay OI khoảng cách từ O đến 1 a mặt phẳng (SAB) Tam giác SOK vuông O, OI đường cao     SO  2 OI OK SO a Diện tích đáy S ABC D  4SABO  2.OA.OB  3a ... (SAC) (SBD) vuông góc với mặt phẳng (ABCD) nên giao tuyến chúng SO  (ABCD) Do tam giác ABD nên với H trung điểm AB, K trung điểm HB ta có a DH  AB DH = a ; OK // DH OK  DH   OK  AB  AB...
  • 4
  • 280
  • 0
Đề Thi Thử Đại Học Khối A, A1, B, D Toán 2013 - Phần 37 - Đề 11 (có đáp án) pot

Đề Thi Thử Đại Học Khối A, A1, B, D Toán 2013 - Phần 37 - Đề 11 (có đáp án) pot

Ngày tải lên : 19/03/2014, 20:20
... + b)   (a + b) (a - b)2  Đẳng thức xẩy a = b * Từ (*)  a3 + b3  ab (a + b) ;b3 + c3  bc(b + c) ; c3 + a3  ca(c + a)  2 (a3 + b3 + c3 )  ab (a + b) + bc(b + c) + ca(c + a) (1) * Áp dụng BĐT ... hA  SBC hA SA S hA  SBC SBC 3VS ABC a a hA = = Vậy hM = d(M;(SBC)) = VSBC 3 2 V(1 điểm) * Ta cm với a, b > có a + b  a b + ab (*) Thật vậy: (*)  (a + b) (a2 -ab + b2) - ab (a + b)   (a ... dương ta có: 1 1 1 + +  33 3 = (2) a a a a b c abc * Nhân vế với vế (1) (2) ta BĐT cần cm.Đẳng thức xẩy a = b = c VI .a. 1(1 điểm) * Đường tròn (C) có tâm I(2;1), bán kính R = Ta có IA = > R  A nằm...
  • 4
  • 272
  • 0
The a and b adapters are used as priming sites for both amplification

The a and b adapters are used as priming sites for both amplification

Ngày tải lên : 19/03/2014, 22:32
... ssDNA bead to be loaded into a well • Enzyme beads and packing beads are added Enzyme beads containing sulfurase and luciferase, and packing beads used only to keep the DNA beads in place • Above ... • The strands are denatured using sodium hydroxide to release the ssDNA template library (sstDNA) The Adapters • The A and B adapters are used as priming sites for both amplification and sequencing ... and the beads are released • Enrichment beads are added (containing biotin); these attach to DNA rich beads only • A magnetic field filters all DNA rich beads from empty beads, and then extracts...
  • 19
  • 390
  • 0
Báo cáo khóa học: Trypanosoma brucei oleate desaturase may use a cytochrome b5-like domain in another desaturase as an electron donor docx

Báo cáo khóa học: Trypanosoma brucei oleate desaturase may use a cytochrome b5-like domain in another desaturase as an electron donor docx

Ngày tải lên : 23/03/2014, 12:20
... 35 I5 (respectively: 5¢-CATGTCAC GGCTAAGGTAGC -3 and 5¢-CTAAGCAACAGATGG GAGGT -3 ) and GSS 38 K3 (5¢-CCAACGCACCGTTCT TTCG -3 and 5¢-ACTGCGAGTAATGCAGATCC -3 ) identified in the T brucei genome database ... thaliana x6 desaturase (P4 631 3), 32 % identity and 51% similarity to endoplasmic reticulum x3 desaturase from A thaliana (P486 23) , and 30 % identity and 51% similarity to chloroplastic x3 desaturase ... degree and type of fatty acid desaturation between trypanosomes and their mammalian host, indicate that fatty acid desaturases may be good targets for trypanocidal drugs Fatty acid desaturases are...
  • 8
  • 277
  • 0
Đề Thi Thử Đại Học Khối A, A1, B, D Toán 2013 - Phần 37 - Đề 12 (có đáp án) docx

Đề Thi Thử Đại Học Khối A, A1, B, D Toán 2013 - Phần 37 - Đề 12 (có đáp án) docx

Ngày tải lên : 25/03/2014, 01:20
... = AI + IH = Ta có HC  AC  AH  AC AH cos 45  HC  2 Ta có I =   Vì SH  ( ABC )  ( SC ; ( ABC ))  SCH  60 ; SH  HC tan 60  a 15 1 a 15 a 15 VS ABC  S ABC SH  (a )  3 2 BI  AH ...  3t  ln t   2  2 2 t 22 22 2 t t  t t  = ln  Câu III(2) Tính thể tích khoảng cách IA a •Ta có IA  2 IH  H thuộc tia đối tia IA IA = 2IH , BC = AB  2a ; AI= a ; IH= = 2 a 3a AH ... (a; b; c)  O véctơ pháp tuyến (P)Vì (P) qua A( -1 ;1 ;0)  pt (P) :a( x+1)+b(y-1)+cz=0 Mà (P) qua B(0;0;-2) a- b-2c=0  b = a- 2c; Ta có PT (P):ax+ (a- 2c)y+cz+2c =0 2a  c (C;(P)) =    2a  16ac...
  • 4
  • 125
  • 0